top of page

A Gain-of-Function (GOF) a véletlen segítségével húzós sikert ért el. Ördögi zsenialitás...












A Gain-of-Function (GOF) a véletlen segítségével húzós sikert ért el – A SARS-CoV-2 vírusba beillesztett kulcsszekvencia legalább NÉGY különböző funkciót adott hozzá


A TATCAGACTCTCAGACACTAATTCTCTCCTCGGCGGGCACGT ördögi zsenialitásának leleplezése


A cikk eredetije angolul itt olvasható.


Ha Fauci fedezeti alapkezelő lenne, akkor messze nagyobb nyereséget lenne képes hozni, mint a részvénypiacok. Ez az ember mindig jól keres az évente kiosztott számos, több milliárd dolláros támogatással. Olyan következetesen hozza a kívánt kutatási eredményeket, hogy Las Vegas igen gyorsan csődbe menne, ha lehetővé tenné az embereknek, hogy fogadásokat kössenek arra, hogy milyen sikereket fog elérni egy Fauci által támogatott kutatás. És amint látni fogjuk, a Gain-of-Function támogatások megtérülése egészen elképesztő.

Megnövekedett az érdeklődés a Covid19 eredete iránt, különösen most, hogy a tudomány többé-kevésbé elismerte, hogy valószínűleg laboratóriumi eredetű. Olyan dokumentumok tömkelege került nyilvánosságra, amelyek a Covid19 "megjelenéséhez" vezető GOF típusú kutatások és kísérletek menetét és változását mutatják be.

Nemrégiben alkalmam volt beszélgetni egy NIH kutatóval (aki névtelen marad, hogy elkerülje a bosszúszomjas kormányzati bürokraták és a despota Pharma/Tech vállalatok megtorlását). Az illető egy olyan kutatócsoportnak volt a tagja, amely a SARS-CoV-2 vírus és a vakcinák genetikai kódját (genomját) elemző kísérleteket végzett (ezek nagy része a The Functional Consequences of the Novel Ribosomal Pausing Site in SARS-CoV-2 Spike Glycoprotein RNA című tanulmányban olvasható).





Ez a tudós elmondta azt, hogy a tüskefehérjében lévő furin hasítóhely betétet körülvevő genetikai szekvencia legalább 4 olyan tulajdonsággal rendelkezik, amely funkcionális kiterjesztést jelent. Annak az esélye, hogy egy ilyen rövid "szuperszekvencia" a természetben véletlenszerűen előforduljon, gyakorlatilag nulla. Ami még fontosabb, annak az esélye, hogy a géntechnológiával foglalkozó kutatók egy olyan mesterségesen beillesztett szekvenciát használjanak, amely "csak úgy véletlenül" 4 különálló, igen jelentős tulajdonságot hordoz magában, ugyanilyen csekély. Ez arra utal, hogy a SARS-CoV-2 vírusnak a pusztító erejét – különösen a fertőzőképessége vonatkozásában – szándékosan tervezték meg és hozták létre, és ennek az érdekében jelentős erőfeszítéseket tettek a kutatás során.

A másik, a csoportjuk által tett felfedezés a kovid vakcináknál történt "kodon-optimalizálás" néven ismert genetikai módosítás egy fajtájának meggondolatlan alkalmazásával kapcsolatos (erről bővebben az írás végén).

Ebben a cikkben a laikusok számára is érthetően magyarázzuk el a megállapításokat és megfigyeléseket.

Azt, hogy ez végső soron mit jelent, és hogyan illeszkedik a covid eredettörténetével kapcsolatos bizonyítékok és tudományos felfedezések mozaikjának tágabb összefüggésrendszerébe, nem tudom. Remélhetőleg idővel a kirakós összes darabkáját megkapjuk.


Balról jobbra, felülről lefele:

Antony Fauci NIH vezetőkje, USA kormányzati tanácsadó,

Ralph Baric, aki egyebek mellett koronavírusokba illeszt HIV szekvenciákat,

Bill Gates, a Pfizer, Moderna társtulajdonosa,

Peter Daszak és a “Vuhani Denevérnő”

mindketten a vihani laborban kutattak – egyebek mellett



A megértéshez kis háttérinfó: Az RNS és a fehérje transzláció 101

Az alábbiakban egy rövid alapozót olvashatunk arról, hogyan íródik/kódolódik az RNS, és hogyan alakul át fehérjévé:

  • A fehérje egy hosszú, láncszerűen összekapcsolt, aminosavakból álló lánc.

  • Az RNS egy kód, amelyet az adott fehérje létrehozásához lefordítanak, és azon aminosavak pontos szekvenciája, amiből a célfehérje áll.

  • Maga az RNS egy nukleotidokból álló lánc - ezek a genom úgynevezett "építőkövei" (bár az RNS nukleotidjai nem azonosak a DNS-ével).

  • Az aminosavakat 3 nukleotidból álló blokkok, úgynevezett kodonok kódolják. Például 3 Citozin nukleotid egymás után (CCC) kódolja a Prolin (P) aminosavat.

  • Kulcsfontosságú, hogy majdnem minden aminosavat több kodon kódol. Az alábbiakban néhány aminosav kódjait mutatjuk be - amint láthatjuk, az alább felsorolt aminosavak közül kettő kivételével minden aminosav többféleképpen kódolható:


  • Az ugyanazon aminosavat kódoló különböző kodonok nem egyformák. Vannak például bizonyos kodonok, amelyek jobban "működnek" vagy alacsonyabb " hibarátát" produkálnak az emberi sejtekben, miközben ez az állati sejtek esetében már nem igaz rájuk.

  • A "kodon-optimalizálás" a természetes (a természetben előforduló) kodonok - ebben az esetben a covid vírus által használt kodonok - megváltoztatását jelenti olyan kodonokra, amelyek jobban alkalmazhatók ("optimalizálhatók") az emberi sejtekben való használat szempontjából. A vakcinagyártók nagyon sok "optimalizálást" végeztek. A tanulmány azt vizsgálja, hogy a vakcina kodonoptimalizálása hogyan befolyásolja a fehérje transzlációját.

  • A riboszómák azok a sejtben lévő "gépek", amelyek "olvassák" az RNS-t, és létrehozzák (lefordítják) az RNS által kódolt fehérjét.

  • Ha érdekel, egy tíz perces rövid videóban vizuálisan is láthatod, mi történik, ez magyar nyelvű, itt tekinthető meg.

A fehérjék nem úgy néznek ki, mint a kígyók, hanem - szó szerint - mindenféle bonyolult és összetett formára hajtogatódnak. Itt van például egy ábra (egy gyártótól) arról, hogy mivé hajtogatódik a kovid vírus tüskefehérjéje:


  • Figyeljük meg, hogy a "lánc" hogyan csavarodik és tekeredik össze-vissza egy bonyolult és összegabalyodott szörnyeteggé, amely semmiben sem hasonlít egy egyágú láncra vagy "kígyóra". A fehérje alakja rendkívül fontos. Ha ez csak egy kicsit is eltér, ez óriási különbséget eredményezhet a fehérje működésében és abban, hogy az immunrendszer hogyan lép kölcsönhatásba vele.

  • Egy fehérje különböző szegmensei (peptidjei) egyedi, eltérő funkciókkal vagy tulajdonságokkal (képességekkel) rendelkeznek. Például az egyik szegmens lehet toxikus és mérgező, miközben a többi tökéletesen ártalmatlan. Képzeljük el a fenti képen, hogy a különböző színű részek mindegyike valami mást csinál (ez egy torz leegyszerűsítés, de ez az alapvetés).

  • A fehérjék már a fordítás/létrehozás folyamatában elkezdenek hajtogatódni. Más szóval, amíg a riboszóma az egyik végén az aminosavak hozzáadásával van elfoglalva, a másik végén már a hajtogatási folyamat zajlik. (A hajtogatás rendkívül összetett biokémiát foglal magában, ami messze túlmutat e cikk keretein.)

  • A fehérjék összehajtogatódása egy finom folyamat, amely mindenféle tényező által megváltoztatható, megzavarható vagy manipulálható. Számunkra mos különösen az a fontos, hogy az RNS-nek fehérjévé történő fordításának a fehérje közepén történő szüneteltetése vagy leállítása megváltoztatja a fehérje hajtogatódását. Hasonlóképpen, egy másik kodon szintén megváltoztathatja a fehérje hajtogatását.

  • Ami a tüskefehérjét illeti, 2 része van, az S1 és az S2. Az S1 a "fej", amely az S2, a "test" tetején ül. Az S1 tartalmazza a tüskefehérje majdnem összes toxikus részét.

SARS-CoV-2 GOF funkcionális fejlesztések a kulcsfontosságú inzert szekvenciában


A SARS-CoV-2 tüskefehérje közel 1300 aminosav hosszú (általában "maradványok" vagy " aminosavmaradványok" néven említik); a konkrét szám a változattól függően változik. A minket érdeklő rész a 674-685. maradványból áll:


(#674) Y-Q-T-Q-T-N-S-P-R-R-A-R (#685)


Tyrosine (674) / Glutamine (675) / Threonine (676) / Glutamine (677) / Threonine (678) / Asparagine (679) / Serine (680) / Proline (681) / Arginine (682) / Arginine (683) / Alanine (684) / Arginine (685)


Azok a nukleotidok (emlékezzünk a korábban említett "kodonokra"), amelyek ezeket az aminosavakat az eredeti Wuhan-vírus genomjában kódolják, a súlyos akut légzőszervi szindrómás koronavírus 2 izolátum Wuhan-Hu-1, teljes genomjában (a teljes kovid genom 23.582-23.617-es nukleotidjai), a következők:


TAT / CAG / ACT / CAG / ACT / AAT / TCT / CCT / CGG / CGG / GCA / CGT


A fenti szekvencia tartalmazza a hírhedt, Moderna által szabadalmaztatott genetikai szekvenciát CT/CCT/CGG/CGG/GCA/CGT/AG (az utolsó két betű nem szerepel a fenti részben) , amely valahogy "utat talált" a SARS-CoV-2 genomjába (meg kell hagyni, hogy azok a bosszantó kínai denevérek tökéletes genetikai Frankensteint készítettek).

Gondolom, mostanra már szinte mindenki, aki ezt olvassa, tisztában van azzal, hogy létezik egy Moderna által szabadalmaztatott szekvencia (ezt dokumentálja az Homology and Potential Recombination Link to SARS-CoV-2 Furin Cleavage Site című tanulmány).

(Megjegyzés: nem avatkozom bele a Moderna által szabadalmaztatott szekvencia körüli vitába, hogy ez valóban egy az egymilliárdhoz típusú "véletlen" vagy sem. Csak ennek a szekvenciának a funkcionalitásával foglalkozunk).1


Stephane Bancel, a Moderna egyik tulajdonosa, CEO,

és a 2016-os furinhasítóhelyre vonatkozó szabadalom egyik tulajdonosa.


A 4 funkciófejlesztés ebben a szekvenciában

Az a NIH kutató, akivel hosszasan beszélgettem, a következőket mondta: A stratégiai Furin Site/Moderna szabadalmi szekvencia betétnek (legalább) *NÉGY* különböző funkciója van, amelyek mindegyike fokozza a covid virulenciáját és patogenitását:

  1. Furin hasítóhely - P-R-R-A2 (681-684. maradék) - drámaian növeli a tüskefehérje sejtmembránhoz való sikeres kapcsolódásának lehetőségét és valószínűségét (a sejtfelszíni fehérjéhez, elsősorban az ACE2-hez való kezdeti kötődés után).

  2. A HIV-motívum - Q-T-Q-T-N (675-679. maradék) - a HIV tüskefehérje egy olyan része, amely sokkal fertőzőbbé teszi és segít a T-sejtek megfertőzésében.

  3. Enterotoxin peptid – az egész szekvencia – egy peptid (egy fehérje darabja), amely szó szerint egy erős toxin.

  4. Riboszomális szünetelő hely - CGG/CGG (23,606-23,611 nukleotidok, amelyek a 682-683-as maradékoknál egymás mögött elhelyezkedő arginineket kódolják) - jelentősen fokozza a spike-fehérje transzlációjának egységességét, így sokkal kevesebb "tönkrement" vagy " hamis" fehérje keletkezik; emellett "fél-tüskefehérjék" - más szóval magányos S1-darabok - keletkezéséhez vezet, amelyek sokkal veszélyesebbek, amikor leválnak a tüskefehérje S2 feléről.

(...)

 

588 megtekintés

Comments


legte Tanka.jpg

VARGA DOMOKOS GYÖRGY művei itt és a wikin

dombi 2023.jpg
vukics boritora.jpg
acta 202305.png
gyimothy.png
dio.jpg
KIEMELT CIKKEK
MOGY2023.jpg
bottom of page