top of page

A „hullámgenetika” nem lehetséges, de a DNS-t és az emberi gondolkodást kutatni kell



Egyikünk Facebook ismerősei közül ketten is megosztották az alábbi bejegyzést 2021. április közepén:

„Garjajev fizikus professzort a hullámgenetikai tanulmányaiért 2020-ban Nobel-díjra jelölték, de azt már nem vehette át, miután a covid vírus lehetséges terjedése és az 5G kapcsolatában komoly összefüggést fedezett fel, és mindezt nyilvánosságra is hozta, hirtelen, minden betegség és egyéb előjel nélkül, makkegészségesen elhalálozott november 17-én... Garjajev azzal próbálkozott, hogy bizonyos információkat közvetített a génekhez, a kvantumok szintjén, és észrevette, hogy ezen információk hatására a gének megváltoznak: megszűnik egy betegség, vagy épp létrejön egy másik. A nyelvi hullámgenetika lényege, hogy a génekhez küldött információ képes a gének kvantum mezejére hatni, és azok információs tárházát módosítani. Számos kísérletével bizonyította állításait, ezeknek mind utána lehet nézni. Egy igen érdekes és fontos meglátása a vírusokkal kapcsolatban volt: felfedezte ugyanis, hogy a vírusok kétféle módon is terjedhetnek: fizikailag, és mező (hullám) formájában. Garjajev képes volt egy vírusos fertőzést semlegesíteni azáltal, hogy a vírus genetikai hullám-mezőjét semlegesítette. Nézzük meg még egyszer, mit is jelent a fenti állítás: a vírusok nem csak fizikailag terjedhetnek (például levegő vagy érintés útján), hanem kvantum szinten is, mint információ. Hogy ez mit jelent? Azt, hogy a vírus nem kell fizikailag jelen legyen ahhoz, hogy valaki elkapja. Ahogy a hagyományban is számtalanszor találkozunk azzal, a ténnyel, hogy a betegséget nem a konkrét fizikai kórokozók okozzák, úgy ezt maga Garjajev is bizonyította. Elég csak a vírus információja jelen legyen (bennünk), és létrejön a betegség. Ha ezt igazán felfogjuk, akkor megértjük, … hogy a védekezés hiábavaló, sem maszk, sem elzárkózás nem óv meg minket egy fertőzéstől. Az éberség azt jelenti, hogy a velünk való történéseket, betegségeket értelmezni tudjuk, vagyis éberen figyelünk. Ha elég éberek vagyunk, akkor elég információt tudatosíthatunk mindabból, ami bennünk van, és ez a tudás az igazi védelem: a kegy, amely megvéd mindattól, amit a nem tudatos tartalmaink okozhatnának. ’Az embernek magasabb szellemi szintre kell emelkednie, hogy mentálisan meg tudja védeni magát, létre kell hoznia egy mentális burkot, rá kell vennie a szervezetét arra, hogy »védelmi« üzemmódban működjön. Sejtjeinket megtaníthatjuk arra, hogy ne fogadják be, vagy vezessék inaktív állapotba ezt az információt, hiszen az ember tudata képes befolyásolni ezeket a torziós mezőket’ – mondta Pjotr Petrovics Garjajev egy interjúban."[1]


A több tucat hozzászóló helyeselte, üdvözölte Garjajev eredményeit és azt, hogy felhívták rá a figyelmét. Többen a jólértesült magabiztosságával emlegették az 5G és az mRNS összefüggését. Hogy a már az Öböl-háborúban is alkalmazott technikát Garjajev tovább fejlesztette, és megkapta volna érte a Nobel-díjat 2020 szeptemberében, de hirtelen kiesett a XIV. emeleti lakása ablakából (amely hír egyébként valójában nem róla szólt[2]). Valaki még hozzátette, hogy az 5G fegyvernek lett fejlesztve: mikrohullám, mint a mikro sütő, van, amit lehet vele hatásosan melegíteni, de egy csomó étel szabályosan szétrobban benne. Azt is kiemelték, hogy a szisztematikus, nyomasztó félelemkeltés képes megteremteni a betegséget akkor is, ha nincs ott „kórokozó”. Ezért is sulykolják egész nap a riasztó és hazug adatokat, hogy mindenki féljen, stresszeljen, ne legyen egy nyugodt pillanata sem – nem mehetnek a napra, a friss levegőre, és nem érezhetik magukat jól családi, vagy baráti körben sem, mert az jókedvvel és vidámsággal töltené el őket, ami a stressz ellenszere.

További érvelés: Jelenleg a föld lakossága 7 857 910 000 ember, és a világjárvány kitörése, 2020. január óta 2021. áprilisig világszerte 2 900 000 emberre mondták, hogy COVID-ban halt meg. Tehát naponta 6 823 ember, egyéb fertőző betegségekben pedig kb. napi 40 000. A 6 823 COVID-os elhunyt százalékban kifejezve naponta az emberiség 0,000086 százaléka. Ez 10 millió/8-9 napi arány. Nálunk 10 millió/53 fő. De mikortól beszélhetünk világjárványról? És jön a vád, hogy bár minden elveszett élet tragédia és részvét jár minden elhunyt hozzátartozójának, de nem lenne szabad emberek százezreit megfosztani isten adta szabadságuktól, munkájuktól, fiatalokat és a gyerekeket szocializációhoz való joguktól. Hónapokig otthon bezárva, távol a napfénytől és a friss levegőtől, közben passzívan szenvedni a média folyamatos médiaterrorizmusát. Bedőlve a politikusoknak és tenyerükből etetett tudósoknak. Ilyesmi utoljára korábbi náci és kommunista diktatúra időszakában volt, a tudósok ott vezettek le ilyen és hasonló komoly okfejtéseket igazuk bizonyítására. Persze őket is az akkori politikusok etették, itatták, ellátták mindenféle földi jóval. Tömegeket vezettek orruknál fogva, és láttuk mi lett a vége.

Aztán valaki az agyig felszúrt genetikai tesztről beszél, amivel vírusjelenlétet hazudnak. Azaz hogy teljesen szabályellenesen végeznek PCR teszteket (amik amúgy sem alkalmasak vírus jelenlétének kimutatására) sorozatban, millió szám, mert nem így kell vírus és bacilus tesztet venni az orrból, mert neki vagy 6 éve elvégezték azt a vizsgálatot és nem így kell, hogy az agygátig belekotorsz egy mintáért. Hanem ez azért van, mert ez egy genetikai kísérleti teszt, hiszen a COVID vakcinák nagy része is géntechnológiás valami. Annyi vírust mutatnak így ki, amennyit hazudnak, a valóságban ez a teszt erre alkalmatlan. Ősi egyiptomi módszer ez, a Thébai Nagytemplom hieroglifjein lehet olvasni ezt a metódust, de az egyiptomiak is átvették valakiktől, ugyanis ez a fajta beavatkozás, orron át az agyhámi gát megsértése az emberekben a pánikközpontot és a félelem központot aktiválja. Ezt tudományosan reptilián agydúcnak nevezik, ez felelős a félelemérzet kialakulásáért többek között. Nos, az ókori Egyiptomban a rabszolgákat, akiket befogtak a piramisok építésére, előtte alávetették ennek a beavatkozásnak, ugyanis ezzel módosítani tudják az emberi agy „reptilián” idegdúcát és ha jól csinálják, a „PCR tesztet” akkor a személy, akin ezt elkövetik, állandó rettegésbe, egyfajta halálfélelmi tudatalatti állapotba kerül, és így engedelmes, befolyásolható, tökéletes rabszolga a piramisépítés halálos munkájában. Ez most része lett a médiában, politikumban közvetített megfélemlítési metódusnak, az emberek rettegik a PCR tesztet és ez a rettegés állandósult pszichózissá válik. A megfélemlített tömeg engedelmesen retteg, hordja a maszkot, és nem mer visszaugatni, akkor sem, ha az anyját vagy a gyerekét előtte kaparják el fekete hullazsákban, miután kinyírták a protokoll szerint.

Volt egy a dolgot elítélő hozzászólás is: „Mekkora baromság!” Akit aztán figyelmeztettek, hogy a svédeknél nem véletlenül merült fel Garjajev neve a Nobel-díjjal kapcsolatban. Az egymást becsmérlő szóváltásban aztán Garjajev már Nobel-díjas professzorként szerepel.

Jön is a megjegyzés, hogy Garjajev tragédiája tipikus példája annak, hogyan üldözi a gyógyszermaffia és a háttérhatalom az őket leleplezőket. És ez a hozzászóló szeretné megtudni, hogy a rezgések, amiket Garjajev a COVID hatásainak ellensúlyozására–kivédésére dolgozott ki, vajon egy-egy alkalommal vagy folyamatosan közvetítendők? És közzé teszi Garjajev egyik kaleidoszkóp szerűen változó, leginkább mandálákra emlékeztető rajzkavalkádja videójának linkjét, mint ami az eléggé monoton zenével együtt nyugtatóan hat és az immunrendszer megerősítésére szolgál.[3]

Ezekből a hozzászólásokból lájuk, hogy a hozzászólók egyrészt készpénznek vették Garjajev találmányát, bár nem nagyon tudták, mi is az valójában, másrészt a COVID vírus elleni indulataikat, a helyzet miatti elkeseredésüket vagdalkozó módon, mindenféle álhírekkel és álösszefüggésekkel tarkítva megpróbálták az általuk vélt bűnbakok nyakába varrni.

Most pedig olvassuk el Garjajevnek a bejegyzés végén ajánlott videója fordítását, amelynek címe: A beszéd hatása a gyermekeinkre:


„Minden, amit a történelem folyamán leírtak, lényegét tekintve genetikai anyag, mert a DNS az egyfajta beszéd, a beszéd pedig egyfajta DNS. A beszédszerű genetikai információ kialakítja az emberiség, azon belül az egyes ember szellemi testét. Amikor a gyermekünket neveljük – beszélünk hozzá. A tanítók is beszélnek hozzá. A beszéd gyermekkoruntól kezdve beágyazódik agyunkba. Ezáltal a beszéd alakítja a szellemi testünket. Nem a fizikai, hanem a szellemi testünket, ami megfoghatatlan, de mégis nagyon fontos aspektus. Ha egy nevelési célzatú beszéd tele van szabálytalanságokkal, hibákkal, még ha csak a legegyszerűbbet is vesszük, mint a káromkodás, a szitkozódás, akkor ez egy mutáció. A maga nemében a beszédünk, a genetikai anyagunk mutációja. Ha létrehozunk valamilyen koncepciót, mint például a fasizmus, akkor az már úgy viselkedik, mint egy vírus. Ha ezáltal a fiatal generáció ’üres’ fejébe beágyazódik valamilyen ideológia, akkor ez a beszédszerű információ, pontosabban dezinformáció, torzszülötteket hoz létre. Ebben rejlik a kultúra, a normális emberi beszéd, a nyelvtani értelemben vett hibátlan, ’piszkos’ szavak nélküli beszéd jelentősége. A helyes ideológiát kell beültetni az ember fejébe. A gyermekeknek helyesen kell tanulniuk, ami egy megszokott dolog kell legyen. Ha mégis helytelen dolgokra, mondjuk fasizmusra, wahabizmusra vagy más szélsőségekre tanítjuk őket, akkor szellemi torzszülött – mutáns válik belőlük. Olyan torzszülött, amely mindent megöl, kiirt maga körül, majd ennek eredményeként maga is elpusztul. Ez a válasz a nyelvezet fontosságára a genetikai szerkezet vonatkozásában, amelynek még szellemi összetevője is van: az úgynevezett Lelkünk. A Lélek pedig szavakból áll. Vegyünk egy könyvet, ami egyfajta anyag. Jelekkel teletűzdelt papír. Akár el is égetheted gond nélkül. De ha értelmet adunk neki, akkor ez az értelem egy ideális alkotóelem lesz, amely elválik a szövegtől és a fejünkbe ágyazódik. Nevezzük őt szövegkromoszómának. Ha szabályszerű, hibátlan, nem mutáns, akkor minden rendben. A gyermek jó irányba fog fejlődni, és egy normális, egészséges ember lesz belőle. Ha a gyermek ideális részeskéjét célzottan eltorzítjuk a saját céljaink szerint, akkor egy torzszülöttet nevelünk fel. Szellemi torzszülöttet, habár fizikailag nagyon is erős és szép ember lesz. De a szellemi teste megfoghatatlan marad…”[4]


Ebből rögtön látható, hogy Garjajev álláspontját a redukcionizmus jellemzi, azaz a bonyolultabb visszavezetése az egyszerűbbre. Így tud mintegy a genetika nyelvére terelni egyébként átlagos emberi tapasztalatok által megszerezhető mondanivalót. A redukcionizmus a tudományfilozófiában sokáig bírált álláspont volt, mert egyértelmű, hogy a visszavezetésen túl a redukcionizmus másik értelme szintén megvalósul, a lecsökkentés. Hiszen az elme visszavezetése a testi mivoltra (fiziológia), az pedig a kémiára, fizikára nemcsak elveszi az emberi nagyszerűség eredeti értékét, értelmét, hanem még olyan következtetésekre is vezet, hogy az emberi törekvések, erkölcsi értékválasztások mögött egyszerű testi vágyak állnak. Hol van már Adam Smith, aki a három alapszükséglet (élelem, ruha, lakás) mellé negyediknek odatette a luxus irántit is. Az újbaloldali ügynökök ugyanis lesöpörték ezt a tudományfilozófiai és egyúttal a józan belátással is egyező ellenvetést, s manapság már oda jutottunk, hogy a privát nyelv fogalmához hasonlóan csupán egyéni vágyak létezését tételezik, de azokat mindenkinél másnak és másnak. Ám ahogy a nyelv is közös, mégis ragaszkodnunk kell ahhoz az önmagunkhoz, aki legalábbis törekszik mindenkivel azonos lenni: „Hiába fürösztöd magadban, csak másban moshatod meg arcodat” (József Attila). S hogy erre ma nálunk is vevők lettek sokan, annak oka, hogy bizonyosságot keresnek, és a DNS itt úgy van előadva, mint amely rendelkezik szinte az istenéhez hasonló teremtő erővel, vagy másként mondva, mintha a DNS működésének megismerése által közvetlenül istennel folytatnánk társalgást, ami felemelő érzést kelt bennünk. Miközben nemcsak a hagyományos értelemben istenkáromlás ez, hanem tudományos értelemben is hamis, megtévesztő. De utóbbit éppen bonyolultsága miatt nem láthatják egyből, meg az igen-igen drága, kevesek számára hozzáférhető, végezhető eljárások miatt, ahogy azt kutatni lehet. Ezért vállalkoztunk a leleplezésére, legalábbis a fizikai alapok terén, amely ennek az írásnak a második felében, azaz alább olvasható. Előbb láttuk, hogyan fogadja a nagyközönség az ilyesmit, azaz miért van szükség a hamisság leleplezésére.

Másik nagy gond ezzel az egésszel, hogy tautologikus, azaz nem mond többet, nem mondja el azt a többletet, amiről szó van, hanem lecsökkentve beszél róla, de így már a csökkentett nyelven megragadott valóság lesz rá jellemző, nem az az eredeti, amit így leképezett. Ez jól látszik Garjajev szövegében akár a káromkodás, akár a szélsőséges társadalomelméleti vagy ideológiai irányzatok mint emberformáló tényezők emlegetésekor. Annyira leegyszerűsíti a dolgokat, hogy már mosolyogni lenne kedvünk rajta, ha nem lenne vészesen komoly, hogy ezt az emberek majd elhiszik. Nemcsak azt nem vizsgálja, hogy mik alakítják ki, milyen céllal ezeket az említett jelenségeket, hanem azt sem, hogy miképpen juthat el, milyen közvetítéssel, akár a gyerekekhez, akár úgy általában az emberekhez. Azt az áthallást ugyanis, amit a wahabizmus gyermekekre gyakorolt befolyásolás tekintetében újabban megismertünk, nehéz a „fasiszta társadalom” felnőtt tagjaira átvinni. De egyáltalán problémás itt az utóbbi fogalma is, mert hogy ne derüljön ki, hogy a nemzeti szocializmus is szocializmus volt, a Szovjetunióban a „német fasizmus” kifejezést használták a nácizmusra. És úgy látszik, hogy Garjajev még ezt a szovjet kommunista időkből visszamaradt fogalmat használja, hiszen világos, hogy nem az olasz fasizmusra gondolt.

És Garjajev úgy tesz, mintha mindig mindenről tudnánk, hogy helyes-e vagy helytelen. Mintha nem próbálkozásokból állna össze a tapasztalat. A gondolatot, a fogalmak, mondatok jelentését is valami önálló tényezőnek tekinti, ami beágyazódik a fejünkbe szerencsés esetben, mert egyébként helytelenség, mutáció is beágyazódhat. Szereti ezt a „beágyazódik” szót, és a redukcionizmusa is folytatódik, mert ehhez a külön valaminek a beágyazódásához kell, hogy „a Lélek pedig szavakból áll”-jon. Ami annyiban alapvető tévedés, hogy már Arisztotelész logikai találmánya óta tudjuk, hogy beszédünk állításokból (propozíciókból, azaz mondatokból, de leginkább esetleg több mondatos gondolatokból) áll, nem szavakból.

A két ismerős kapott tőlünk egy figyelmeztetést az alábbi szöveggel:


„A hullámgenetika ilyen felvetése megdöbbenti azokat, akik kicsit is jártasak a fizikában. Sőt ezt az egész gondolatsort a lehetetlenségek közöttinek tekintik. Csak információ? Milyen információt lehet átsugározni egy DNS-re, amitől annak szerkezete megváltozik? Az anyagi szerkezet energiát képvisel. Honnan veszi az 'információ' az átalakításhoz szükséges energiát?

Még hogy Garjajev kísérleteket folytatott... Fizikából elégtelen! 5G és a koronavírus kapcsolata? Merthogy felfedte és a XIV. emeletről röppent ki… Na, ne mán! Legenda. Ezzel kapcsolatos régebbi fizikusi élmény: X Y (megvan a neve) a DNS kvantumszintjeivel foglalkozott, végzett számításokat. A kvantumszintek mindegyike egy bizonyos szerkezetet feltételezett és a kvantumszintek gerjesztése, kisülése nem volt elegendő a DNS molekuláris szerkezetének a megváltoztatásához, csupán az atommagok körüli elektronfelhőt határozták meg. A DNS helikális szerkezetében a bázisok síkokat határoznak meg és ezen síkok pi-elektronfelhői átfedtek – innen az állapotok béli források oka.

Vírus genetikai hullám mezejét semlegesíteni? Plafonszakasztó kifejezés!

Ha ezt tudományként terjeszteni lehet, akkor sajnos a szellemi szint kezd hihetetlenül alacsonnyá válni.

A szellemi erőnek nincs lehetősége egy fizikai létezőt semlegesíteni, csak arra van ereje, hogy a szervezet immunrendszerét erősítse és majd az védekezik. Az e=mc2 szabály nem veszítette el az értelmét – az ezoterikusok bármennyire is szeretnék.”


Az egyik ismerőstől nem jött válasz, míg a másik kérdezte, hogy Masaru Emoto neve ismerősen cseng-e? Nem csengett, de utánanéztünk: Japán „vízkutató” volt, aki szerint az emberi tudat megváltoztatja a víz szerkezetét. Azaz azt akarta az ismerős ezzel jelezni, hogy ha a gondolatok megváltoztatják a vizet, akkor a hullámgenetika is működik.

Közbevetőleg hadd jegyezzük meg, hogy a kvantummechanika az hullámmechanika néven is ismeretes, de az itteni „hullám” előtagnak (a „hullámgenetikában”) a kvantumokhoz az ég-egy világon semmi köze. A későbbiekben bemutatott modulált lézer sugár ugyan hullám, de a kvantummechanika valójában atomok elektronszerkezetének leírására jött létre, és ott állóhullámokról van szó. Egy-egy pálya energiája hullámfüggvénnyel közelíthető, és ott az egyes pályákon állóhullámok alakulnak ki. Ennek pedig az a feltétele, hogy a hullám mentén egész számú periódus legyen. Ez az egész szám feltételezi a kvantumszámokat. A lézer-fényre magára, a kvantummechanika nem vonatkoztatható.

Ha a Japánról eddig nem hallottunk, a jelenségről igen, mert pár évtizede körbement mifelénk is. Amint a hozzászólások is tartalmazzák, hogy mintegy ha a szobanövényeket szidják, elszáradnak, ha dicsérgetik, akkor meg sokkal szebbek, mert a virágcserépben a víz átveszi az érzelmeket. Ami ezek szerint őhozzá köthető. A Wiki szerint „Masaru Emoto was a Japanese businessman, author and pseudo-scientist who claimed that human consciousness could affect the molecular structure of water”[5]. Itt az első foglalkozása a legfontosabb, mert a vízkristály fényképezés ezek szerint jó üzletté vált. Mindegy, hogy érvényes képet ad, vagy trükk-e. A világ tele lett a tudományos eszközök félrehasználatából származó megtévesztésre alkalmas eszközökkel és „eredményekkel”.

Iskoláinkban az új tanrend szerint is csökken a természettudományok tanításának mértéke, intenzitása, színvonala. Csak Einstein egyik gondolata tolul ilyenkor az agyba: „A világon két dolog végtelen: a világmindenség és az emberi butaság. A világmindenségben már nem vagyok annyira biztos.

Ráth-Vég Istvánnak is van egy könyve: Az emberi butaság története. Ebben olvasható a következő tétel: „A földön az intelligencia mennyisége konstans, csak a lakosság száma növekszik.”

A hiszékenység, a csodára való sóvárgás, a lehetetlen megvalósítása, az elődök ismeretlen szuper tudásának hajszolása... folytassuk? Mindezek uralják lassan a társadalmi szellemi világot.

Nem véletlen, hogy a misztikus vallások törnek előbbre, nem véletlen, hogy a távoli nagy „gondolkodók” tanai aratnak. Nem véletlen, hogy a nyugati szellemileg csalódottak Indiába utaznak szellemi igényeik feltöltésére – számtalan példa van rá. Aztán mit kapnak? Legfeljebb misztikumot. (Lásd itt a Szilaj Csikón a Tudás népe című írást.)

Golding A legyek ura c. könyve egy szigeten játszódik, a képzelet világában. A magukra hagyott gyerekek zöme azonnal a misztikumba menekül és azokat, akik elméje tiszta maradt, s még tudnak gondolkozni és van is bátorságuk hozzá, ki akarnák takarítani maguk közül. A zsidó gyereket megölik és a másikat csakis az angol katonák megérkezése menti meg a közvetlen haláltól.

És akkor a víz szerkezetével kapcsolatban: ismerjük a víz konfigurációit, az erőtereket – ezeket a tereket lehet számolni, használni a topokémiai tanulmányoknál.

Tudattal befolyásolni? Igen, lehet. De nem úgy, ahogy leírják, hanem sokkal közvetettebben, más értelemben. Ha elfelejtjük az előzetes elméleteket és elvégezzük a kísérleti munkát, és kézbe véve az eredményeket, az adatok birtokában nyúlunk hozzá az elméletekhez, és kereshetjük meg közülük azt, amely az adatok értelmezéséhez valóban használható. Ha nincs, akkor meg kialakítjuk az adatok alapján. Mert ha az elméletekből indulunk ki, akkor a kísérleteket óhatatlanul úgy vezetjük, hogy az abból várható eredmény jöjjön ki. Minden adatot, amely nem illik bele, elfelejtünk, kiejtünk és nem találunk újat, nem lesz eredmény. A másik úton pedig igen. Így lehet tehát „szellemileg”, „tudatilag” befolyásolni a szerkezetet. Esetünkben a vizet. Hogy rá hagyatkozunk és azt találjuk, amit közölni képes velünk, és azt is írjuk le, és nem eleve keresünk egy elképzelésre bizonyítékot, mert a képek alapján „olyan, mintha” ez lehetséges volna.

Még pár hozzászólást ismertetünk Garjajev videós szövege kapcsán a Végtelen forrás c. honlapról.

Volt, aki zseniálisnak találta, mert maga is mindig szinte fizikai fájdalmat érez, ha valaki káromkodik körülötte. Olyan negatív rezgést küld felé, hogy Isten bocsánatát kéri rá gondolatban. S volt, aki köszönte a világos szavakat, mert ugyan szégyenli, de ő is káromkodik, csúnyán beszél, mert ez számára egyfajta biztonsági szelep, viszont igyekszik változtatni és nem káromkodni a jövőben.

Más vélemény szerint az iskolába kellene ezt bevinni, mert ma a gyerekek 99%-a lefele lógó fejjel a telefonját nyomkodva közlekedik, 10 fiatalból 9 azt sem tudja, mi az élet értelme, csak a Facebook. Ám a beírót figyelmeztetik, hogy a gyerek a telefont otthonról hozza, otthon engedik és veszik meg neki. Nem az iskolát kell hibáztatni. Az viszont igaz, hogy a tinik körében sikk lett a csúnya beszéd. És van egy mondás, hogy a gonosz szavak megölik a Lelket, mert lélekrombolók. Kellenek okos érvek, kell láttatni a teljes világot. És eszünkbe kell jusson: „Kezdetben vala az Ige.

Van ellenvetés is: A szavaknak annyi ereje van, amennyire az elmédben akaratod elleni reakciót vált ki. Az a személy, aki mentes az aberrációktól, arra semmilyen szó nincs „káros”, sem idegesítő, sem egyéb – a személy által kontrollálhatatlan – hatással.

Valakit azért fogott meg, mert valóban így működőnek látja a hatást. Így értjük meg JÉZUS URUNKAT (is), mikor tanítványaival közölte: „GONDOLATAITOK PEDIG LEGYENEK TISZTÁK!” Mily csodálatos értéket hagyott ránk, de „MI”, emberi lények sajnos nemtudásunk miatt folyamatában torzítottuk el a világ rendjét és most valóban többszörösen tér vissza hozzánk minden förtelmével együtt. De ezt nem ISTEN teszi, hanem egykoron, amit MI emberek elvetettünk, az mostanra ért be, szökött szárba és hozott termést. Erre is megvolt a tanítása JÉZUS URUNKNAK: „KI MINT VET, ÚGY ARAT, vagy KI MIT, VET, AZT ARAT”. És sajnos MI, emberek mind a mai napig csak bújunk a tudatlanságunkkal a nem kívánatos események felé! Pedig elég volna, ha csupán „BOCSÁNATOT” kérnénk, meglátnánk eltévelyedésünket és a következő mondattal szépen, tiszta szívvel és szeretettel felülírnánk egykori „KORCS” gondolkodásunkat és azt BOLDOGAN megköszönnénk a TEREMTŐNKNEK. Az ígért mondat a következő (nem szabad kinevetni, ez nem vicc, hanem igenis véresen komoly): „ÉN DNS-em szeretettel arra utasítalak, hogy gyógyítsd meg minden sejtemet. Hálásan köszönöm.” Ezt bármikor, s elég csak gondolatban önmagunkban mondogatni, bármilyen munkavégzésünk közepette, és figyeljük csak majd meg: 21 napra rá folyamatosan kezdődik a gyógyulás, és 90 napra teljesen helyreáll az egészségügyi állapotunk. Arról nem is beszélve, hogy mennél több ember végzi e DNS programozását saját magán, az eljut a morfogenetikus mezőbe (közös KOLLEKTÍV TUDATNAK is mondhatjuk) és egyre biztosabb a siker. Ilyen egyszerű. A legegyszerűbben van a legnagyszerűbb, mikor a TEREMTÉS elméletéről van szó.

És akkor a „virágkísérlet”: Egyszer egy tanár kitett két virágot az iskolában. Mind a két virág ugyanannyi napfényt és vizet kapott. A tanár megkérte a gyerekeket, hogy az egyik virágot szidják, szekálják, a másikat szeressék. Az a virág, amelyiket szekálták, szidták, elsorvadt, kisebb, fejletlenebb lett. A másik virult. De ezt megcsinálták a vízzel is. Ott, amelyiket szidták, abban a pohárban a vízmolekulák eltorzultak. Megposhadt a víz. Ezek érzelmi hullámok. Az ember szervezete, ha jól emlékszem, 80%-ban tartalmaz vizet. Ezen dolgokon nyugodtan elgondolkozhat az, akinek gyermeke van. Milyen sokat számít a dicséret, a szeretet neki. De, egymásra is így hatunk.

Aztán egy sommás ellenvélemény: „Ennyi hülyeséget fapofával végigmondani!”

Erre az volt a válasz, hogy ha majd ha évtizedekig tanulmányozza a keleti filozófiákat, vallásokat, akkor értékesebb lesz a véleménye. Így csak a sötétség megnyilvánulása.

És végül valaki beidéz egy tudományos igényű, cáfoló cikket dr. Hantz Péter biofizikustól (Pécsi Tudományegyetem, Általános Orvostudományi Kar, Biofizikai Intézet és Fibervar Kft., Kolozsvár) és dr. Péterfi Zoltán infektológus, belgyógyász szakorvostól (Pécsi Tudományegyetem, Általános Orvostudományi Kar, I. sz. Belgyógyászati Klinika):


„Vannak gyógyítók, akik a biorezonancia révén kezelik a hozzájuk fordulókat. Utánanéztünk, és kiderült, hogy minden szélhámos mást ért biorezonancia alatt, ami nem is csoda, hiszen ilyen tudományos fogalom nem létezik. Azok közül, akik ezzel a szóval dobálóznak, egyet sem találtunk, aki akár a középiskolai fizika tananyag részét képező rezonancia fogalmával tisztában lett volna. Egy másik sikeres posztszovjet szélhámos, Peter Gariaev tudományosnak látszó katyvasszal (nyelvi hullámgenetika, kvantumgenetika, Fermi-Pasta-Ulam memória – ezen értelmetlen kifejezések darabjai viszont létező fogalmakat jelölnek) csalogatja Moszkvába a jó pénzt fizető kuncsaftokat. Gariaev saját bevallása szerint a New York-i Tudományos Akadémia tagja. (Megjegyezzük, hogy ez az intézmény egy szép honlappal rendelkező, komolytalan szervezet, melynek bárki tagja lehet évi 135 dollárért.) Gariaev még családi problémák megoldására is vállalkozik. Kezelései bonyolult hókuszpókusz szerint zajlanak, egy adott ponton a szegény pácienst egy faládába fektetik és valami zajt hallgattatnak vele. Utána be kell mutassa egy gyerekkori fényképét, és újabb zajt kap, hogy azt majd otthon hallgathassa. A pár órás csomag potom 1000 dollárba kerül. Ha valaki személyesen nem lehet jelen, annak 500 dollárért küldenek hallgatni való zörejt. Sajnos sokan csak annyit látnak a honlapján lévő halandzsából, hogy sok bonyolult szakkifejezés van egybegyúrva, ezért biztosan egy jó dolog lehet: Gariaev a tudomány fogaival harap a tudományba. Vajon hányan dőlnének be ilyen trükköknek, ha azzal autójavítás örve alatt próbálnák lehúzni az embereket?”[6]


Írásában a két szerző egyébként még ezeket a szélhámossági címszavakat tárgyalja és leplezi le: A koronavírussal kapcsolatos tévhitek, Gyógyítás számok és rezgések által, A pH-biznisz, Krónikus fájdalmak kezelése mágneses talpbetétekkel, Kristálygyógyítás, Homeopátia, A pi-víz, Oltásellenesség, Szopogatni való C-vitaminos cukorka, Méregtelenítés, Immunerősítők, Digitális fertőzés, Vizsgálatok szenzitív kikristályosítással, Fényevők, Jó és rossz zsírok, Karotenoidok, "Ismeretterjesztés", Celladam, Culevit.

És akkor végezetül jöjjön még az írásunk elején ígért cáfolat a hullámgenetika léte fizikai lehetetlenségének bemutatása által.

Garjajev tehát akadémikus lett, de az akadémiai tagságáért tagdíjat kellett fizetnie. Mit számít, lényeg a cím, a rang. Még ha esetleg semmit nem is fedezett fel. Nem is kell, hiszen bár kiderült, hogy az Ősrobbanás elméletének alaptételei is hibásak – az elemi fizika alapján beláthatóan, mégsem érdekel senkit.

Rémes, hogy ha valaki valamilyen díjat kapott (Garjajevet állítólag jelölték), az már bármekkora ökörséggel előállhat, a nagyérdemű tapsikol: Nobel-díjas mondta! Einstein szavai ma is törvények, holott neki is volt bőven tévedése, például nem tudta elfogadni a statisztikus valószínűségi folyamatokat, mondván, „az Isten nem szerencsejátékos”.

Hát ez bizony nem más, mint a tekintélytisztelet.

Garjajev intézetének honlapjáról (https://wavegenetics.org/) letölthető az a két anyag, amely az ő „kísérleteinek” leírása. Az egyik orosz nyelvű – ez az elmélet (111. oldal). A másik angol, a DNS kvantumportálási kísérlete. Hullámgenetikának nevezik, mert a HeNe lézer vörös fényének hullámait használják hozzá. Hullám, de ahogy fentebb írtuk, ettől még nem lesz kvantum! A lényege a következő:

PCR-el megsokszoroznak egy adott 597 bázisú rendszert.

Abból mikroszkóp tárgylemezen HeNe lézerrel felvételt készítenek úgy, hogy a másodfokú reflexiót hanggá alakítják egy rádiókészülékben. Minthogy ez hangfrekvenciás jelsorozat, ezért az eljárást nyelvészetnek is tekintik.

Meg kellett nézni, hogy valójában az a hangkép, amelyet Garjajev ezekről a löttyökről kap, valójában fizikailag mi is? Lehet, hogy olyan területre való, amelyen Garjajev tényleg nagy lehetett, de aztán átlépett az ezoterikus vonalra – és a tekintélye viszi ott is. Snóbli díjra felterjesztett volt, de nem tudjuk, milyen indoklással. A hullámgenetika szerepel a tudományos teljesítményei között. Csakhogy: az mire való?

Nem, nem az. És itt jön megint az alapvető fizika: a HeNe lézerrel besugárzott anyag mellett egy rádió vevőkészülékkel, annak a 700 kGHz-es frekvenciáján jelentkező »hangokat« rögzítik. A mintában a vizes, pufferes és egyéb szükséges anyagokkal ellátott közegben megsokszorozott DNS van. A rá eső vörös fény hatására keletkező másodlagos rádiósugárzást moduláló hangfrekvenciát rögzítik. Hogy miért 700 kHz-en? Azt nem tudjuk. Hogy miként hordozza ez a hanganyag a DNS molekuláris jellemzőit, mint információt? Azt sem tudjuk, talán valahol leírták, de nem megyünk utána. De elemi fizikai ismereteink szerint semmi ilyesmit nem hordozhat – éppen ezért a fentiekben leírt ún. gyógymód, a hangok hallása az emberi szövet sejtjeire sem gyakorolhat semmiféle hatást. Legalábbis: közvetlenül semmit.

Aztán ezzel a hanggal vezérelt lézerrel kezelnek biológiai tisztaságú vizet.

Aztán jön ismét a PCR technika, ahol 40 ciklussal megsokszorozottan kimutatják az eredeti DNS szekvenciákat.

Bumm!

Ez tudományosnak tűnik, csak van egy nagy bibi: a PCR teszttel 25-28 ciklusig lenne szabad elmenni, mert annál hosszabb ciklusnál – már 35-nél is – üres mintával is pozitív eredményt adhat.

Itt adott is.

Nem vittek át az egyik DNS vizes oldatból semmit a biológiai tisztaságú vízbe! A kimutatási technikájuk hibás.

Nyelvészet, mert a másodlagos reflexió hangfrekvenciás rezgést jelent – ahogy a beszélt nyelv is az. De semmi köze a nyelvhez, a nyelvekhez!

Garjajev olyan modelleket kezdeményezett, amint a fölvezetőjében látszik, hogy a nem anyagi részekre, terekre alkalmazta a Schrödinger egyenletet.

Végig lehet menni rajta, ahogy a teleportáló kísérletén is részletekben, mert megadja a löttyök összetételét is, de abból semmi lényeges nem kihámozható.

A lényeg azonban: PCR vizsgálattal dönti el, hogy a lézeres kezelés után az adott összetételű DNS molekula keletkezett-e, átjutott-e, kialakult-e ott? És 40 ciklust használ... Ez biztos.

Hogy hogyan kerül a vizes közegbe a DNS szerves részét alkotó foszfor, nitrogén és szén, az nem világos. A PCR teszt után használt spektroszkópiai vizsgálat erről nem szolgáltat eredményt, mert nem arra való.

De annyi bizonyos: a HeNe lézer hullámhossza a vörös fénynek felel meg, 0.633 mikrométeres hullámhosszú, és a destruktív, szerves vegyületek szétbontó sugárzás hullámhossza ennél több nagyságrenddel rövidebb, azaz bőven nanométer alatti tartományban van (ultraibolya, röntgen, stb.). Egy hangfrekvenciás modulálással meg ezek – még ha holográf elven használják is – iszonyúan kis energiák anyagátalakításhoz. Hogy csak maga a hangfrekvenciás moduláló hullám egyáltalán milyen információt hordoz, hordozhat – hát az is rejtély. Annyi biztos, hogy a vizes oldatban lévő DNS molekulák szerkezetéről aligha hordoz bármiféle információt, legkevésbé a főlánc mentén meglévő bázisok sorrendjéről.

Az eredeti leírást a Függelékben mutatjuk, s bárki megítélheti, hogy ez humbug, ez kamu. Ha nem az lenne, akkor a nem kezelt vízzel ugyanezt a vizsgálatot elvégeznék, és megmutatnák a teszteredmények közötti különbséget. Nem tették meg.

A kísérlettel azt igyekeztek bemutatni, hogy fénysugárzás segítségével (innen a hullám megjelölés) biológiai tisztaságú vízbe „transzportálták” a DNS-t (innen a megjelölés második tagja, a genetika) – pusztán információ odasugárzásával. De azért valamiről megfeledkeztek: a víz oxigénből és hidrogénből áll, ki is emelik, hogy semmi mást nem tartalmaz, a biológiai tisztáság még az oldott nitrogén és oxigén tartalmat is kizárja. A DNS-ben pedig zömmel szén (C), nitrogén (N), és a főláncban foszfor (P) atomok is vannak.

Alább számok következnek.


A HeNe lézer vörös fénye, 633 nm-es hullámhosszúságú. 1 eV energia megfelel 2.41796591 1014 Hz-es fénynek, amelynek hullámhossza 1240.7412281 nm. A HeNe lézer energiája tehát 1.96 eV.
Itt kell megjegyeznünk, hogy az 5G frekvenciája kb. 30 GHz, ami kb. 1 cm-es hullámhossznak felel meg, azaz a HeNe lézerénél 3 nagyságrenddel kisebb energiát jelent. Így ennek hatása a vírus-DNS-re (a COVID-19 RNS-ére) még inkább elenyésző. Azaz Garjajev az 5G és a COVID-19 vírusa között semmi olyan összefüggést nem találhatott fel, amely az életébe kerülhetett volna.
Az elektron tömegenergiája 551 000 eV.
A proton tömegenergiája: 938 GeV, azaz 938 milliárd eV.
A neutron tömegenergiája: 938 GeV – és az 5. tizedesben +1, azaz gyakorlatilag ugyanannyi –, úgyhogy ennyi egy nukleon tömegenergiája.
Egy szegmens a DNS láncon tartalmaz egy foszfátot – azaz 95 nukleont –, egy dezoxi-ribózt – azaz 150 nukleont –, plusz a négy bázistól rendre 125 (T), 130 (C), 150 (G) és 134 (A) nukleont. Egy átlagos szegmensben van tehát 380 nukleon és ezek kisebb hányadát adja a H, ill. az O, amely a vízben jelen van.
Hogyan kerül a vízbe a DNS többi összetevője, a P, a C és a N? A P 31, a C 12, a N meg 14 nukleont jelent. Ezek mindegyikének oda teremtése szegmensenként több mint 1000 GeV energiát igényel, miközben a modulált lézer sugár energiája 1.96 eV, azaz 12 nagyságrenddel kisebb.
A DNS, amit állítólag oda teremtettek, ráadásul még több mint fél ezer szegmensből állt.
A 1.96 eV-os fényt hiába sugárzom oda hosszú időn át, az energia nem összegezhető, egy-egy nukleon, meg egy-egy atommag létrehozásához annak teljes tömegenergiáját képviselő sugárzás szükséges.

Ez csak az energia oldal, de ennyi elég, mert ez alapfizika, amiről nem tudnak.

Sem Gargajev, sem az őt idézők.[7]

Ezen felül van még a bázisok sorrendjének a kérdése – amelyet az a bizonyos hangfrekvenciás hullám, mint a HeNe lézer erősségét moduláló vezérlő információ, képtelen meghatározni.


Összegezve a tanulságokat, elmondható, hogy érthetően elemi erős kíváncsiság vezérli a mai embereket a világ és benne az ember megismerésére. E törekvésükben azonban őket a magas tudomány nemhogy kielégítené, de észre sem veszi kívánságukat. Pedig gyakorlatilag ők teszik lehetővé, hogy legyen magas tudomány, amely így gyakran elefántcsonttoronyba zárkózik, illetve a jogdíjak, szabadalmi díjak üzleti érdeke mögé, valamint a katonai titkok hivatkozását említhetjük. Vannak tudósok persze, és még többen nem a tudományt művelők, akik „eredménnyel” jelentkeznek, és a nagyfokú igény miatt meghallgatásra is találnak. Van benne persze valós eredmény is, hogy ők érvényesülni tudnak, de az vagy el van túlozva, vagy nem megengedhető módon átvíve, következtetve más területre, azaz kiterjesztve. Ezzel az írásunkkal nem ítéletet akarunk mondani, hanem csak figyelmeztetni, hogy ne dőljünk be mindennek, ne várjunk mindenáron hatást ott, ahol nincs, és bízzunk jobban a hagyományos tudásunkban, amely mögött évmilliós tapasztalat áll. Ezt ismerték fel a vallások, amelyek megtanították az ilyen mély gyökerek tiszteletét. És ezt vitték tovább az igazi tudományban, amely megnyitotta számunkra önmagunk és a világ megismerését. Ahogy Vörösmarty mondta:


„Mi dolgunk a világon? küzdeni
És tápot adni vágyainknak.
… küzdeni erőnk szerint a legnemesbekért.” 


Cser Ferenc, Darai Lajos


 

Függelék:

Materialization of DNA molecules

Phantom another being and materialization of DNA molecules. Experiments.

Winner of the Nobele Award 2008., for their discovery of human immunodeficiency virus, Luc Montagnier and sponsors (Jamal Aissa, Claude Lavallee, Luc Montagnier ) patented method “teleportation” DNA www.google.com/patents/WO2012142568A2?cl=en, then, l. Montagnier published a article about this

This work has caused a stormy, mostly negative, reactions in the scientific world, as it turns our perceptions of the roles of DNA and confronts the task of explaining this phenomenon physicists. The method is complicated and not actually Montagnier discovered in detail.

We have developed a much more simple and easily reproducible method of quantum transmission of copies of DNA based on laser technology, that is confirmed by PCR.

Publishing perspectives working genes on the basis of such technology are vast. First of all, This programming stem cells. This gives a real opportunity to regenerate the retina – return the vision (the precedent of this we have created), regenerate teeth (the precedent of this we have created), generally all the organs and tissues, endocrine glands, to eliminate damage to the spinal cord and brain (the precedent of this we have created), shoot the chromosomal damage, for example, in cystic fibrosis (the precedent of this we have created), turn off the extra chromosome in down's syndrome (the precedent of this we have created), treat the terminal stage of cancer (We have done). And much more. This is potentially a huge business.

Further work in this direction will yield even more powerful impetus to the development of biology, biokomp′ûtingu, medicine, Agriculture, biointernetu, deep space communications, etc. d. We have published some theoretical analysis of this phenomenon, We actually received long before the work of l. Montagnier — based on the example of quantum transmission running complex genes to regenerate the pancreas in rats [Garyaev P., Kokaya A., Mukhina I., Leonova-Garyaeva E., Кокая Н. Г., 2007, Effect of modulated electromagnetic radiation on biostrukturami for alloksanovogo of diabetes mellitus in rats. Бюллетень Эксп. Биол. и Мед., # 2, с. 155-158],

http://www.tgdtheory.fi/curri.html L. Montane group experiments nobody played, because the key points method not revealed even in the patent.

Now it is time to reproduce the experiments of Luc Montagnier, but in a different way, using our laser technology. We have implemented this. Significantly, It was discovered by a whole new set of phenomena, accompanying the "teleportation" quantum equivalent of DNA in water. Deliberately giving these primary results without parts and without discussion. Early. Main, What we have also demonstrated the possibility of PCR DNA synthesis on a purely aqueous matrix, which recorded the wave equivalent of DNA in the form of a DNA fragment of the modulated wideband electromagnetic field (MBER). This is a secondary electromagnetic field used by us laser. The theory of education of secondary field is given in our article [I.v. Prangishvili, P.P. Garyaev, G.g. Dmitri Tertyshny, Vladimir Maksimenko, A.v. Mologin, E. Leonova, E.r. Ernest. Sensors and systems, # 9 (18), c. 2-13 (2000g.) SPECTROSCOPY OF LOCALIZED RADIATION PHOTON-WAVE: ACCESS TO NON-LOCAL QUANTUM BIO-INFORMATIONAL PROCESSES]. But, Once again, did we not, How did a group of Luc Montagnier.

Here is the result of our experiments on the synthesis of DNA fragment in his Phantom. Let Me Remind you, DNA phantoms I managed to detect and register in 1984. Details in monograph Gariaev P.p., 2009g., «Lingvistiko-wave gene. Theory and practice ". Kiev. 220s.

Methods for Amplification. Phantom 547 bp long DNA. with Polymerase Chain Reaction (PCR) Using Modulated Secondary Broadband Electromagnetic Radiation (MBER) of LGN-303 Laser as a Quantum Equivalent of Analogous Material DNA .

text=”experiment 1″] [button link=

For a complete description of the method of detection and materialization of phantoms DNA PCR System.

Step 1. Getting the original DNA product The PCR product of 547 bp was taken as a starting DNA product, for the receipt of which used a cloned in plazmidnom vector synthetic sequence. Plus a chain of DNA:

5′-CCTTACGTCAGTGGAGATGTCACATCAATCAACTTGCTTTGAAGACGTGGTTGGAACGTCTTCTTTTTCCACGATGCTCCTCGTGGGTGGGGGTCCATCTTTGGGACCACTGTCGGCAGAGGCATCTTGAATGATAGCCTTTCCTTTATCGCAATGATGGCATTTGTAGGAGCCACCTTCCTTTTCTACTGTCCTTGCGCGCTATATTTTGTTTTCTATCGCGTATTAAATGTATAATTGGGGGACTCTAATCATAAAAACCCATCTCATAAATAACGTCATGCATTACATGTTAATTATTACATGCTTAACGTAATTCAACAGAAATTATATGATAATCATCGCAAGACCGGCAACAGGATTCAATCTTAAGAAACTTTATTGCACGCATTAATGGACTGGATTGGGGCCAACTCCTACCGTACCTGGCATTACCCTTACGCTGAAGAGATGCTCGACTGGGCAGATGAACATGGCATCGTGGTGATTGATGAAACTGCTGCTGTCGGCTTTAACCTCTCTTTAGGCATTGGTTTGGAAGCGGGCA-3′

For PCR amplification of DNA-based product used a pair of primers:

5′-CCTTACGTCAGTGGAGATGTCACATC-3′;

5′-TGCCCGCTTCCAAACCAATGCCTAAAGA-3′.

Each PCR mixture was 25 ul final volume contained: 67 mM Tris-HCl pH 8,6 at 25 ° C; 2,5 mM magnesium chloride; 16,6 mM ammonium sulfate; dNTPs mixture at a total concentration of 300 uM; primer mix to 0,5 uM each; 2,5 units. Taq DNA polymerase and plasmid DNA template of 25 ng. PCR temperature control included: initial denaturation at 94° c – 3 min.;

30 cycles: 94 ° C - 30,, 62 ° C - 30,, 72 ° C - 40 with; final synthesis at 72 ° C for 5 minutes.

PCR- the product was purified from primers and PCR reaction components by using the cleaning kit using SiO2-magnetic particles ("Silex", Russia) in accordance with the manufacturer's recommendations. We are using 10 l of magnetic particles with binding capacity 10 ug DNA. The elution of DNA was performed in a volume of 50 ul of elution buffer.

step 2. Getting mŠÈI spectrum DNA product.

A drop of the aqueous PCR product solution in a volume of 25 ul was applied to a clean microscope slide and used to probe beam HeNe laser LGN-303 3 min. And above. Received secondary modulated broadband electromagnetic radiation (MBER) recorded transistor radio at a frequency of 700 kHz and converted into sound wave format. This audio file, we suggest you use to introduce DNA information (without the use of, This version of the, Laser LGN-303) in the samples sterile water, having in mind, that sound can carry torsion http information://www.efir.com.ua/rus/a.php?r = 2&d = 69 , including DNA (hypothesis).

At a distance of 15-20 cm from the laser tripod with tubes placed, containing purified distilled water without impurities DNA, RNA and nukleaz. The water was previously frozen at -20° c and razmorožena at room temperature (melt water).

step 3. PCR amplification using samples of water, processed mŠÈI range of original DNA, which reading information laser LGN-303 After exposure to laser water, processed mŠÈI range, used for the production of standard PCR reactions, 25 .mu.l in volume without adding real template DNA. Tripod tubes placed at a distance of 20-30 cm from the laser. The placing of PCR reactions carried out in sterile box, processed UV light, which prevents contamination of samples.

Each PCR mixture contained: 67 mM Tris-HCl pH 8,6 at 25 ° C; 2,5 mM magnesium chloride; 16,6 mM ammonium sulfate; dNTPs mixture at a total concentration of 300 uM; primer mix to 0,5 uM each; 2,5 units. Taq DNA polymerase. Used several temperature PCR, differing duration phase of elongation (synthesis) strands of DNA at 72° c.

The original PCR temperature control included: initial denaturation at 94 ° C - 3 min.;

40 cycles: 94 ° C - 30,, 62 ° C - 30,, 72 ° C - 40 with; final synthesis at 72 ° C for 5 minutes.

Modified PCR temperature control included: initial denaturation at 94 ° C - 3 min.;

40 cycles: 94 ° C - 30,, 62 ° C - 30,, 72 ° C - 2-7 min.; final synthesis at 72 ° C for 5-7 minutes.

All temperature regimes led to the synthesis of PCR product specified length, but to varying degrees,. The largest number of test specimens of the expected product was observed using a 7-minute DNA strand synthesis in each of 40 PCR cycles.

step 4. Analysis of results of PCR

After the completion of the PCR reaction samples mixed with buffer for gel, containing fluorescent dye SYBR Green I ("Silex", Russia) and analyzed on a 1,5% agarose gel by standard methods of gel electrophoresis in TBE buffer single. Results were analyzed on a transilluminator at 365 nm. Positive thought samples, bands which were at a similar distance from the start, that and the Strip positive control, appropriate size DNA fragment of 547 bp.

Experimental samples were subjected to sequencing, positive control samples PCR and DNA samples, source product, with which made reading laser. Sequencing revealed, The experimental samples 99,2-100% identical to the DNA sequence of the initial product, which made reading laser.

As an illustration of one of our experiments, see picture PCR DNA phantoms. Sound recording mŠÈI DNA in wave format on the frequency 700kGc also provides.

Link to download sound recording wave format DNA Sound 547 o.n. [button

text=”Download”]

PS: Our experiments, you can play without using laser. And without the original DNA matrix (as we also do), i.e.. do not synthesize matrix.

This ensures against accidental closure of the original DNA in working with water tubes, the pipettes, etc.. Thus we go from kontaminacij. In this embodiment, the audio player working set at a distance from 1 to 20 cm from the test tubes with the tripod. Exposure time may vary between 5 minutes and up. Identity formed DNA PCR product and the original DNA sequencing DNA obtained can be set. In this version of the test enough primers and knowledge consistency original DNA nucleotides.

Dr. Peter P. Garyaev. D.b.s., ACAD.. RANS, RAMTN and LIST, TSP. New York EN. Scientific




Lábjegyzetek

[1] https://www.facebook.com/photo?fbid=4216360431727639&set=a.612865842077134. És ajánlják Garjajev itt alább elemzett videóját: https://www.youtube.com/watch?v=DKs2jmmm2jM. Garjajev szakmai életrajza az Institute of Linguistics of Wave Genetics (ИНСТИТУТ ЛИНГВИСТИКО-ВОЛНОВОЙ ГЕНЕТИКИ) honlapján: https://wavegenetics.org/ és https://wavegenetics.org/garyaev/aspectyi/ [2] https://hvg.hu/tudomany/20201221_alekszandr_kaganszkij_vakcinakutato_kiesett_az_ablakon; és hasonló más esetek: https://hvg.hu/vilag/20200504_koronavirus_jarvany_fertozes_oroszorszag_orvos_baleset_tiltakozas_egeszsegugy. [3] https://www.youtube.com/watch?v=TdOLbjLUCqg [4] https://www.youtube.com/watch?v=DKs2jmmm2jM [5] https://en.wikipedia.org/wiki/Masaru_Emoto [6] „Amikor az áltudomány a tudomány fogaival harap.” transindex. A napos oldal. https://eletmod.transindex.ro/?cikk=28312 [7] A Nobel-díjra jelölt Petrovics Garjajev betiltott felfedezése segíthetne minden betegség ellen - A hullámgenetika feltalálója - Kvantumimmunitás - ALTERNATÍV HÍREK (alternativhirek.com); DR PETER GARIAEV - jolelek.lapunk.hu; https://www.tminfo.hu/erdekessegek/tudomany-es-spritualitas-a-dns-t-a-szavak-befolyasoljak/; https://ujvilagtudat.blogspot.com/2020/01/egy-kvantumkiserlet-vilagossa-tette-az.html; https://tothmihalyzoltan.hu/blog/2021/02/02/professzor-gargajev-betiltott-felfedezese-es-rejtelyes-halala/; http://rejtelyekszigete.com/dns-t-szavak-befolyasoljak/; https://vegtelenforras.hu/blog/Kvantumimmunitas-1; https://futotuz.blog.hu/2021/01/22/hullamgenetika; https://kzone.info/post/dZLU17BvgHhrq58/fix-tv

 

4 527 megtekintés

Kommentare


legte Tanka.jpg

VARGA DOMOKOS GYÖRGY művei itt és a wikin

dombi 2023.jpg
vukics boritora.jpg
acta 202305.png
gyimothy.png
dio.jpg
KIEMELT CIKKEK
MOGY2023.jpg
bottom of page